bowtie
Table of Content
About
Bowtie is an ultrafast, memory-efficient short read aligner. It aligns short DNA sequences (reads) to the human genome at a rate of over 25 million 35-bp reads per hour. Bowtie indexes the genome with a Burrows-Wheeler index to keep its memory footprint small: typically about 2.2 GB for the human genome (2.9 GB for paired-end).
Versions and Availability
Module Names for bowtie on qb
Machine | Version | Module Name |
---|---|---|
qb2 | 1.0.0 | bowtie/1.0.0/INTEL-14.0.2 |
qb2 | 2.1.0 | bowtie2/2.1.0/INTEL-14.0.2 |
▶ Module FAQ?
The information here is applicable to LSU HPC and LONI systems.
Shells
A user may choose between using /bin/bash and /bin/tcsh. Details about each shell follows.
/bin/bash
System resource file: /etc/profile
When one access the shell, the following user files are read in if they exist (in order):
- ~/.bash_profile (anything sent to STDOUT or STDERR will cause things like rsync to break)
- ~/.bashrc (interactive login only)
- ~/.profile
When a user logs out of an interactive session, the file ~/.bash_logout is executed if it exists.
The default value of the environmental variable, PATH, is set automatically using SoftEnv. See below for more information.
/bin/tcsh
The file ~/.cshrc is used to customize the user's environment if his login shell is /bin/tcsh.
Modules
Modules is a utility which helps users manage the complex business of setting up their shell environment in the face of potentially conflicting application versions and libraries.
Default Setup
When a user logs in, the system looks for a file named .modules in their home directory. This file contains module commands to set up the initial shell environment.
Viewing Available Modules
The command
$ module avail
displays a list of all the modules available. The list will look something like:
--- some stuff deleted --- velvet/1.2.10/INTEL-14.0.2 vmatch/2.2.2 ---------------- /usr/local/packages/Modules/modulefiles/admin ----------------- EasyBuild/1.11.1 GCC/4.9.0 INTEL-140-MPICH/3.1.1 EasyBuild/1.13.0 INTEL/14.0.2 INTEL-140-MVAPICH2/2.0 --- some stuff deleted ---
The module names take the form appname/version/compiler, providing the application name, the version, and information about how it was compiled (if needed).
Managing Modules
Besides avail, there are other basic module commands to use for manipulating the environment. These include:
add/load mod1 mod2 ... modn . . . Add modules rm/unload mod1 mod2 ... modn . . Remove modules switch/swap mod . . . . . . . . . Switch or swap one module for another display/show . . . . . . . . . . List modules loaded in the environment avail . . . . . . . . . . . . . . List available module names whatis mod1 mod2 ... modn . . . . Describe listed modules
The -h option to module will list all available commands.
Module is currently available only on SuperMIC.
Usage
bowtie --help for command line options e.g., bowtie -c prefix-index-file GCGTGAGCTATGAGAAAGCGCCACGCTTCC bowtie prefix-index-file reads.fq bowtie-build seq.fna index-file
Resources
Last modified: August 21 2017 10:47:37.