mpiblast
Table of Content
About
mpiBLAST is a freely available, open-source, parallel implementation of NCBI BLAST. By efficiently utilizing distributed computational resources through database fragmentation, query segmentation, intelligent scheduling, and parallel I/O, mpiBLAST improves NCBI BLAST performance by several orders of magnitude while scaling to hundreds of processors. mpiBLAST is also portable across many different platforms and operating systems. Lastly, a renewed focus and consolidation of the many codebases has positioned mpiBLAST to continue to be of high utility to the bioinformatics community.
Versions and Availability
▶ Display Softenv Keys for mpiblast on all clusters
Machine | Version | Softenv Key |
---|---|---|
None Available | N/A | N/A |
▶ Softenv FAQ?
The information here is applicable to LSU HPC and LONI systems.
Shells
A user may choose between using /bin/bash and /bin/tcsh. Details about each shell follows.
/bin/bash
System resource file: /etc/profile
When one access the shell, the following user files are read in if they exist (in order):
- ~/.bash_profile (anything sent to STDOUT or STDERR will cause things like rsync to break)
- ~/.bashrc (interactive login only)
- ~/.profile
When a user logs out of an interactive session, the file ~/.bash_logout is executed if it exists.
The default value of the environmental variable, PATH, is set automatically using SoftEnv. See below for more information.
/bin/tcsh
The file ~/.cshrc is used to customize the user's environment if his login shell is /bin/tcsh.
Softenv
SoftEnv is a utility that is supposed to help users manage complex user environments with potentially conflicting application versions and libraries.
System Default Path
When a user logs in, the system /etc/profile or /etc/csh.cshrc (depending on login shell, and mirrored from csm:/cfmroot/etc/profile) calls /usr/local/packages/softenv-1.6.2/bin/use.softenv.sh to set up the default path via the SoftEnv database.
SoftEnv looks for a user's ~/.soft file and updates the variables and paths accordingly.
Viewing Available Packages
The command softenv will provide a list of available packages. The listing will look something like:
$ softenv These are the macros available: * @default These are the keywords explicitly available: +amber-8 Applications: 'Amber', version: 8 Amber is a +apache-ant-1.6.5 Ant, Java based XML make system version: 1.6. +charm-5.9 Applications: 'Charm++', version: 5.9 Charm++ +default this is the default environment...nukes /etc/ +essl-4.2 Libraries: 'ESSL', version: 4.2 ESSL is a sta +gaussian-03 Applications: 'Gaussian', version: 03 Gaussia ... some stuff deleted ...
Managing SoftEnv
The file ~/.soft in the user's home directory is where the different packages are managed. Add the +keyword into your .soft file. For instance, ff one wants to add the Amber Molecular Dynamics package into their environment, the end of the .soft file should look like this:
+amber-8
@default
To update the environment after modifying this file, one simply uses the resoft command:
% resoft
The command soft can be used to manipulate the environment from the command line. It takes the form:
$ soft add/delete +keyword
Using this method of adding or removing keywords requires the user to pay attention to possible order dependencies. That is, best results require the user to remove keywords in the reverse order in which they were added. It is handy to test out individual keys, but can lead to trouble if changing multiple keys. Changing the .soft file and issuing the resoft is the recommended way of dealing with multiple changes.
▶ Display Module Names for mpiblast on all clusters.
Machine | Version | Module |
---|---|---|
None Available | N/A | N/A |
▶ Module FAQ?
The information here is applicable to LSU HPC and LONI systems.
Shells
A user may choose between using /bin/bash and /bin/tcsh. Details about each shell follows.
/bin/bash
System resource file: /etc/profile
When one access the shell, the following user files are read in if they exist (in order):
- ~/.bash_profile (anything sent to STDOUT or STDERR will cause things like rsync to break)
- ~/.bashrc (interactive login only)
- ~/.profile
When a user logs out of an interactive session, the file ~/.bash_logout is executed if it exists.
The default value of the environmental variable, PATH, is set automatically using SoftEnv. See below for more information.
/bin/tcsh
The file ~/.cshrc is used to customize the user's environment if his login shell is /bin/tcsh.
Modules
Modules is a utility which helps users manage the complex business of setting up their shell environment in the face of potentially conflicting application versions and libraries.
Default Setup
When a user logs in, the system looks for a file named .modules in their home directory. This file contains module commands to set up the initial shell environment.
Viewing Available Modules
The command
$ module avail
displays a list of all the modules available. The list will look something like:
--- some stuff deleted --- velvet/1.2.10/INTEL-14.0.2 vmatch/2.2.2 ---------------- /usr/local/packages/Modules/modulefiles/admin ----------------- EasyBuild/1.11.1 GCC/4.9.0 INTEL-140-MPICH/3.1.1 EasyBuild/1.13.0 INTEL/14.0.2 INTEL-140-MVAPICH2/2.0 --- some stuff deleted ---
The module names take the form appname/version/compiler, providing the application name, the version, and information about how it was compiled (if needed).
Managing Modules
Besides avail, there are other basic module commands to use for manipulating the environment. These include:
add/load mod1 mod2 ... modn . . . Add modules rm/unload mod1 mod2 ... modn . . Remove modules switch/swap mod . . . . . . . . . Switch or swap one module for another display/show . . . . . . . . . . List modules loaded in the environment avail . . . . . . . . . . . . . . List available module names whatis mod1 mod2 ... modn . . . . Describe listed modules
The -h option to module will list all available commands.
Module is currently available only on SuperMIC.
The soft environment will create a file $HOME/.ncbirc if not present, you can modify as required
[NCBI] Data=/usr/local/packages/mpiblast/1.5.0-pio/intel-11.1-mvapich-1.1/ncbi/data [BLAST] BLASTDB=/work/$USER/MPIBLAST BLASTMAT=/usr/local/packages/mpiblast/1.5.0-pio/intel-11.1-mvapich-1.1/ncbi/data [mpiBLAST] Shared=/work/$USER/MPIBLAST Local=/work/$USER/MPIBLAST
Usage
mpiblast is normally run via a PBS batch job.
▶ Open Example?
Sample PBS Script
The example assumes a mpiblast softenv key has been set using MVAPICH.
#!/bin/sh # #PBS -q workq #PBS -M whatever@whereever.foo #PBS -A my_allocation_code #PBS -l nodes=2:ppn=4 #PBS -l cput=06:00:00 #PBS -l walltime=06:00:00 #PBS -V #PBS -N mpiblast #PBS -m ae export FORMTEXEC=mpiformatdb export BLASTEXEC=mpiblast export EXECDIR=/usr/local/packages/mpiblast/1.5.0-pio/intel-11.1-mvapich-1.1/bin export WORK_DIR=$PBS_O_WORKDIR export NPROCS=`wc -l $PBS_NODEFILE |gawk '//{print $1}'` cd $WORK_DIR $EXECDIR/$FORMTEXEC -i drosoph.nt --nfrags=4 -pF mpirun -machinefile $PBS_NODEFILE -np $NPROCS $EXECDIR/$BLASTEXEC -d drosoph.nt \ -i test.in -p blastn -o results.txt
The script is submitted using qsub:
$ qsub script_name
▶ QSub FAQ?
Portable Batch System: qsub
qsub
All HPC@LSU clusters use the Portable Batch System (PBS) for production processing. Jobs are submitted to PBS using the qsub command. A PBS job file is basically a shell script which also contains directives for PBS.
Usage
$ qsub job_script
Where job_script is the name of the file containing the script.
PBS Directives
PBS directives take the form:
#PBS -X value
Where X is one of many single letter options, and value is the desired setting. All PBS directives must appear before any active shell statement.
Example Job Script
#!/bin/bash # # Use "workq" as the job queue, and specify the allocation code. # #PBS -q workq #PBS -A your_allocation_code # # Assuming you want to run 16 processes, and each node supports 4 processes, # you need to ask for a total of 4 nodes. The number of processes per node # will vary from machine to machine, so double-check that your have the right # values before submitting the job. # #PBS -l nodes=4:ppn=4 # # Set the maximum wall-clock time. In this case, 10 minutes. # #PBS -l walltime=00:10:00 # # Specify the name of a file which will receive all standard output, # and merge standard error with standard output. # #PBS -o /scratch/myName/parallel/output #PBS -j oe # # Give the job a name so it can be easily tracked with qstat. # #PBS -N MyParJob # # That is it for PBS instructions. The rest of the file is a shell script. # # PLEASE ADOPT THE EXECUTION SCHEME USED HERE IN YOUR OWN PBS SCRIPTS: # # 1. Copy the necessary files from your home directory to your scratch directory. # 2. Execute in your scratch directory. # 3. Copy any necessary files back to your home directory. # Let's mark the time things get started. date # Set some handy environment variables. export HOME_DIR=/home/$USER/parallel export WORK_DIR=/scratch/myName/parallel # Set a variable that will be used to tell MPI how many processes will be run. # This makes sure MPI gets the same information provided to PBS above. export NPROCS=`wc -l $PBS_NODEFILE |gawk '//{print $1}'` # Copy the files, jump to WORK_DIR, and execute! The program is named "hydro". cp $HOME_DIR/hydro $WORK_DIR cd $WORK_DIR mpirun -machinefile $PBS_NODEFILE -np $NPROCS $WORK_DIR/hydro # Mark the time processing ends. date # And we're out'a here! exit 0
You can download the database file used in the above script
wget ftp://ftp.ncbi.nlm.nih.gov/blast/db/FASTA/drosoph.nt.gz gunzip drosoph.nt.gz
The input file used was
>Test AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC TTCTGAACTGGTTACCTGCCGTGAGTAAATTAAAATTTTATTGACTTAGGTCACTAAATACTTTAACCAA TATAGGCATAGCGCACAGACAGATAAAAATTACAGAGTACACAACATCCATGAAACGCATTAGCACCACC ATTACCACCACCATCACCATTACCACAGGTAACGGTGCGGGCTGACGCGTACAGGAAACACAGAAAAAAG CCCGCACCTGACAGTGCGGGCTTTTTTTTTCGACCAAAGGTAACGAGGTAACAACCATGCGAGTGTTGAA GTTCGGCGGTACATCAGTGGCAAATGCAGAACGTTTTCTGCGTGTTGCCGATATTCTGGAAAGCAATGCC AGGCAGGGGCAGGTGGCCACCGTCCTCTCTGCCCCCGCCAAAATCACCAACCACCTGGTGGCGATGATTG AAAAAACCATTAGCGGCCAGGATGCTTTACCCAATATCAGCGATGCCGAACGTATTTTTGCCGAACTTTT
Resources
Last modified: August 21 2017 10:47:37.